DNA Melting
A DNA duplex melting with temperature and salt: AT bubbles open first, GC regions hold, and the measured curve tracks the predicted Tm. Swap base pairs to retune it.
- 21.5 KB .bexode
- 10 live inputs
- Responsive fit Layout
Use it
The code follows your customizations. Install with npm i exodeui.
import { ExodeUICanvas } from 'exodeui';
// sci-dna-melting.bexode goes in /public (download it below)
export function SciDnaMelting() {
return (
<ExodeUICanvas
src="/sci-dna-melting.bexode"
fit="Layout" // responsive: redraws at any container size
autoPlay
interactive
style={{ width: '100%', height: 560 }}
/>
);
}Inputs
| Input | Type | Default | Range |
|---|---|---|---|
title | Text | DNA Melting | — |
sequence | Text | ATATTAGCGCGCCGGCTATATAATTAGGCCGCGCTA | — |
temp | Number | 55 | 20 – 100 |
salt | Number | 50 | 10 – 1000 |
hbonds | Boolean | true | — |
speed | Number | 1 | 0.1 – 3 |
accent | Text | #5ee0ff | hex colour |
accent2 | Text | #ff9b6a | hex colour |
bg | Text | #06080b | hex colour |
text | Text | #e6edf3 | hex colour |