Double Helix
A true-geometry 3D double helix built from your sequence. Morph between B, A and Z forms, spin and tilt it, and read length, turns, GC content and melting temperature.
- 21.5 KB .bexode
- 11 live inputs
- Responsive fit Layout
Use it
The code follows your customizations. Install with npm i exodeui.
import { ExodeUICanvas } from 'exodeui';
// sci-double-helix.bexode goes in /public (download it below)
export function SciDoubleHelix() {
return (
<ExodeUICanvas
src="/sci-double-helix.bexode"
fit="Layout" // responsive: redraws at any container size
autoPlay
interactive
style={{ width: '100%', height: 560 }}
/>
);
}Inputs
| Input | Type | Default | Range |
|---|---|---|---|
title | Text | Double Helix | — |
sequence | Text | ATGCGTACGTTAGCCGATCGGATCCTAGGCTA | — |
form | Number | 0 | 0 – 2 |
spin | Number | 6 | 0 – 30 |
tilt | Number | 20 | -60 – 60 |
labels | Boolean | true | — |
speed | Number | 1 | 0.1 – 3 |
accent | Text | #5ee0ff | hex colour |
accent2 | Text | #c08bff | hex colour |
bg | Text | #06080b | hex colour |
text | Text | #e6edf3 | hex colour |